View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9626_low_11 (Length: 223)
Name: NF9626_low_11
Description: NF9626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9626_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 68 - 205
Target Start/End: Original strand, 1906802 - 1906940
Alignment:
| Q |
68 |
ctagatcctccataaagtatctttgatactttcttt-tttggtgtctcatttttatggaaaattaaacccatcataatttctatgatccatgttttctta |
166 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |||| ||||||| |||||||||||| ||||||||||||||| | |||||||||| |||||||| |
|
|
| T |
1906802 |
ctagattctccataaagtatctttgatactttctttgtttgttgtctcaattttatggaaaactaaacccatcataatatttatgatccattttttctta |
1906901 |
T |
|
| Q |
167 |
tagaacttggaagagaaaatttgagaaaaataaaataaa |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1906902 |
tagaacttggaagagaaaatttgagaaaaataaaataaa |
1906940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 55
Target Start/End: Original strand, 1906482 - 1906520
Alignment:
| Q |
17 |
tgtttgatgctattgaattaagcctgatctgcctaccct |
55 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
1906482 |
tgtttgatgctattgaattgagcctgaactgcctaccct |
1906520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University