View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9628_low_13 (Length: 425)
Name: NF9628_low_13
Description: NF9628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9628_low_13 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 283; Significance: 1e-158; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 135 - 425
Target Start/End: Complemental strand, 45175809 - 45175519
Alignment:
| Q |
135 |
ttcgggacatacactgaagatgaggatgctatagatgaggacgaagatgaagaggttgataagttttccttctgatgtgattttatgaacgtttggattg |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45175809 |
ttcgggacatacactgaagatgaggatgctatagatgaggacgaagatgaagaggttgataagttttccttctgatgtgattttatgaacgtttggattg |
45175710 |
T |
|
| Q |
235 |
catcggaactagcgcttgtataggaccttgacttcatttggtacatgcatactaccttcgtagtatgactgactgccgatttattgccctgttatttcat |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45175709 |
catcggaactagcgcttgtataggaccttgacttcatttggtacatgcatactaccttcgtagtacgactgactgccgatttattgccctgttatttcat |
45175610 |
T |
|
| Q |
335 |
acattctatcagcattattctctctaggttcttttcctagatgttttttatactagtaggagtaattgcaaaggtaaccatgcttgatttt |
425 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45175609 |
acattctatcagcattattctctctaggttcttttccttgatgttttttatactagtaggagtaattgcaaaggtaaccatgcttgatttt |
45175519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 17 - 80
Target Start/End: Complemental strand, 45175927 - 45175864
Alignment:
| Q |
17 |
taggagggagatggagaaatctggaggggaaactgtagtgttgagcactggtttgaaaaacaaa |
80 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45175927 |
taggagggagatggagaaatctggaggagaaactgtagtgttgagcactggtttgaaaaacaaa |
45175864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University