View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9628_low_21 (Length: 332)
Name: NF9628_low_21
Description: NF9628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9628_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 115 - 319
Target Start/End: Original strand, 4068286 - 4068473
Alignment:
| Q |
115 |
atgaagaacaccggtatcaaactagcataacatgcaaaagatacaccaacttaacaagctactcaagtgttaatagtctctaacaaaccttgcattgctt |
214 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
4068286 |
atgaaaaacaccggtatcaaactagcataacatgcaaaagatacaccaacttaacaagctactc----------------taacaa-ccttgcattgctt |
4068368 |
T |
 |
| Q |
215 |
ccaaaaacacaaaccaccttctgaagctttcattgtggcttcaaaccaaggctccaacaccaattacaatgcaccaaaacaatcatgacacaaaatgttg |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4068369 |
ccaaaaacacaaaccaccttctgaagctttcattttggcttcaaaccaaggctccaacaccaattacaatgcaccaaaacaatcatggcacaaaatgttg |
4068468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 12 - 125
Target Start/End: Original strand, 4068125 - 4068238
Alignment:
| Q |
12 |
aaaggttgtgaatcatcggtagcttttcattctttctgtaattaactgaattttattaatcaaaacccaaaaggaaggacaaacacgggtacaatgttca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4068125 |
aaaggttgtgaatcatcggtagcttttcattcttgctgtaattaactgaattttattaatcaaaacccaaaaggaaggacaaacacgggtacaatgttca |
4068224 |
T |
 |
| Q |
112 |
aacatgaagaacac |
125 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
4068225 |
aacatgaagaacac |
4068238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University