View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9628_low_28 (Length: 274)
Name: NF9628_low_28
Description: NF9628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9628_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 10 - 258
Target Start/End: Complemental strand, 30079379 - 30079131
Alignment:
| Q |
10 |
acatcatgaatatcattgccaacttccaagcacattgaatgagaaatgagaagtgaaattaccatagcttgtccaagacctaaaacatcccatctttcag |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30079379 |
acatcatgaatatcattgccaacttccaagcacattgaatgagaaatgaaaagtgaaattaccatagcttgtccaagacctaaaacatcccatctttcag |
30079280 |
T |
 |
| Q |
110 |
gaaaaacaaaagaactaacacacccttcttcatcatcatcatcctccacttcatcttcatcaccagccctagtcctaatttgttgttcatcatcctcttc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30079279 |
gaaaaacaaaagaactaacacacccttcttcttcatcatcatcctccacttcatcttcatcaccagccctagtcctaatttgttgttcatcatcttcttc |
30079180 |
T |
 |
| Q |
210 |
ttcatcatggcttctttgactcatactttcaaattcagcacctccacca |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30079179 |
ttcatcatggcttctttgactcatactttcaaattcagcacctccacca |
30079131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University