View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9628_low_31 (Length: 267)
Name: NF9628_low_31
Description: NF9628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9628_low_31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 258
Target Start/End: Complemental strand, 24461061 - 24460821
Alignment:
| Q |
18 |
acctcctccgtccctatatctaaccactcttttgattaaaaaatgcatctctacaatgcatggttgccgccaccggtggcggctcaaaccgccggtgaaa |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |||| |
|
|
| T |
24461061 |
acctcctctgtccctatatctaaccactcttttgattaaaaaatgcatctctacaatgcatggttgccgccaccggtggcagctcaaactgccggcgaaa |
24460962 |
T |
|
| Q |
118 |
gagattcctttgctcgtatcatcgcctctgtcaactcttccttcaaccgtgacgatcccgaatccttttattctactctcaaatacatctccgttcttga |
217 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
24460961 |
gagattcctttgctcgtatcatcgcctatgtcgactcttccttcaaccgtgatgatcccgaatccgtttattctactctcaaatacatctccgttcttga |
24460862 |
T |
|
| Q |
218 |
catgttagttccatttttgaactcttcaattttgtctctgc |
258 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24460861 |
catgttagttccatttttcaactcttcaattttgtctctgc |
24460821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 55 - 256
Target Start/End: Complemental strand, 24479187 - 24478986
Alignment:
| Q |
55 |
aaaaaatgcatctctacaatgcatggttgccgccaccggtggcggctcaaaccgccggtgaaagagattcctttgctcgtatcatcgcctctgtcaactc |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | |||||||| |
|
|
| T |
24479187 |
aaaaaatgcatctctacaatgcatggttgccgccaccggtggcggctcaaaccgccggtgaaagagattcctttgctcgcatcatcgccgccgtcaactc |
24479088 |
T |
|
| Q |
155 |
ttccttcaaccgtgacgatcccgaatccttttattctactctcaaatacatctccgttcttgacatgttagttccatttttgaactcttcaattttgtct |
254 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| ||| |
|
|
| T |
24479087 |
ttccttcaaccgtgacgatcccgaatccgtttattctactctcaaatacatctccgttcttgacctgttagttccatttttcaactcttcaattttctct |
24478988 |
T |
|
| Q |
255 |
ct |
256 |
Q |
| |
|
|| |
|
|
| T |
24478987 |
ct |
24478986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University