View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9628_low_32 (Length: 256)
Name: NF9628_low_32
Description: NF9628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9628_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 42 - 247
Target Start/End: Original strand, 5777563 - 5777768
Alignment:
| Q |
42 |
ggggtgggggtcctcttgtatgtaaattacagaatcctcttcgattgtgatcatgttaattttactaatttctaagtaaatctcttcttggtttcactat |
141 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5777563 |
ggggtggtggtcctctcatatgtaaattacagaatcctcttcgattgtgatcatgttaattttactagtttctaagtaaatctcttcttggtttcactat |
5777662 |
T |
|
| Q |
142 |
acaatataactccaataatggtgagtacatagccaagcattcctatcattgagacagggttttgaaatatcaaaattgagatcacaacagcaactgctcc |
241 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
5777663 |
acaatataactccaataatggtgagaacatagccaagcattcctatcattgaaacagggttttgaaatatcaaaattgagatcaccacggcaactgctcc |
5777762 |
T |
|
| Q |
242 |
ctttgc |
247 |
Q |
| |
|
|||||| |
|
|
| T |
5777763 |
ctttgc |
5777768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University