View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9628_low_40 (Length: 240)
Name: NF9628_low_40
Description: NF9628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9628_low_40 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 21829777 - 21829999
Alignment:
| Q |
18 |
ctcataaaataagaattgatgttagtagttttccttttaacttatttggatttggattggatat--tactcttcttttaactaaaagtttacataaatgc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||| | |
|
|
| T |
21829777 |
ctcataaaataagaattgatgttagtagttttccttttaacttatttggatttggattggatatattactcttctttaaacttaaagtttacataaattc |
21829876 |
T |
 |
| Q |
116 |
ataatttgttctccaaatttcattggagacatttactaaggaataaattggataaagtcacatatatatttacattgttgtaaatattgatctgatcttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21829877 |
ataatttgttctccaaatttcattggcgacatttactaaggaataaattggataaagtcac--atatatttacattgttgtaaatattgatccgatcttg |
21829974 |
T |
 |
| Q |
216 |
attggacaaaccatattttaattgc |
240 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
21829975 |
attggacaaaccatattttaattgc |
21829999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University