View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9629_high_9 (Length: 228)
Name: NF9629_high_9
Description: NF9629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9629_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 13 - 166
Target Start/End: Complemental strand, 32104234 - 32104081
Alignment:
| Q |
13 |
ttatacttggagatgagttatagagtcatattttcagtaatcttattttagttatgatgtctaagatgcaattttaaagnnnnnnnggttttcctagttt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32104234 |
ttatacttggagatgagttatagagtcatattttcagtaatcttattttagttatgatgtctaagatgcaattttaaagaaaaaaaggttttcctagttt |
32104135 |
T |
 |
| Q |
113 |
tgacaatgaataaatttagtgatacttaattgtaatgtgttaagtgtaagtaac |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32104134 |
tgacaatgaataaatttagtgatacttaattgtaatgtgttaagtgtaagtaac |
32104081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University