View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9630_low_13 (Length: 225)
Name: NF9630_low_13
Description: NF9630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9630_low_13 |
 | |
|
| [»] scaffold0219 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0219 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 92 - 212
Target Start/End: Original strand, 10725 - 10845
Alignment:
| Q |
92 |
ccttgttaattttgatgatctctttttcatgcaattacttaaaccttgcatcaaaggggattcagtttgcatcaaactcagacaagtttatgatcaaggt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10725 |
ccttgttaattttgatgatctctttttcatgcaattacttaaaccttgcatcaaaggggattcagtttgcatcaaactcagacaagtttatgatcaaggt |
10824 |
T |
|
| Q |
192 |
gtggaagcttgcaagaataat |
212 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
10825 |
gtggaagcttgcaagaataat |
10845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 90 - 197
Target Start/End: Original strand, 15697808 - 15697916
Alignment:
| Q |
90 |
gcccttgttaattttgatgatctctttttcatgcaattacttaaaccttgcatcaaaggggattcagtttgcatcaaactcagacaag-tttatgatcaa |
188 |
Q |
| |
|
|||||||| |||||||||||||| | | |||||| |||||| |||| ||||||||||||||| ||||||||||| ||||||| ||||| |||| ||| | |
|
|
| T |
15697808 |
gcccttgtaaattttgatgatctatctctcatgctattactgaaactttgcatcaaaggggactcagtttgcattaaactcacacaagacttataatcga |
15697907 |
T |
|
| Q |
189 |
ggtgtggaa |
197 |
Q |
| |
|
||||||||| |
|
|
| T |
15697908 |
ggtgtggaa |
15697916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 73 - 208
Target Start/End: Original strand, 18711195 - 18711333
Alignment:
| Q |
73 |
cttgttctttcgcacaagcccttgttaattttgatgatctctttttcatgcaattacttaaaccttgcatcaaaggggattcagtttgcatcaaactcag |
172 |
Q |
| |
|
||||||| ||||||||||| || |||||| | |||||||| |||| |||||| ||||| |||||||||||||||||| ||||||| ||||||| |
|
|
| T |
18711195 |
cttgttccttcgcacaagctctatttaattctaatgatctcgccttcactcaattatcgaaaccctgcatcaaaggggattcaatttgcattaaactcat |
18711294 |
T |
|
| Q |
173 |
ac---aagtttatgatcaaggtgtggaagcttgcaagaa |
208 |
Q |
| |
|
|| |||||||||||| |||||||||| ||||||||| |
|
|
| T |
18711295 |
acaagaagtttatgatcgcggtgtggaaggttgcaagaa |
18711333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University