View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9630_low_5 (Length: 308)
Name: NF9630_low_5
Description: NF9630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9630_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 1 - 303
Target Start/End: Original strand, 42431877 - 42432179
Alignment:
| Q |
1 |
taataaaccatagagaataatatataacatttggaataaaaacagtgttttgctatgtagtattgcattgctttacaagcaagcatgtaaaataactaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42431877 |
taataaaccatagagaataatatataacatttggaataaaaacagtgttttgctatgtagtattgcattgctttacaaacaagcatgtaaaataactaag |
42431976 |
T |
 |
| Q |
101 |
aaacattatggtacaaaatgacatgtctagaaataatacctttttgcacgcttggggtcaatcaaggcaagttctgcaagcttggccgctgacattgctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42431977 |
aaacattatggtacaaaatgacatgtctagaaataatacctttttgcacgcttggggtcaatcaaggcaagttctgcaagcttggccgctgacattgctt |
42432076 |
T |
 |
| Q |
201 |
ttttggaatcagctgcggacatgtcatctgaacccgagactaacatctcaggtttgattgttgttgacccatccatggactggctatgctggtctctgct |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |
|
|
| T |
42432077 |
ttttggaatcagctgcggacatgtcatctgaacccgagactaacatctcaggtttgattgttgttgacccatccatggactggctatgctggtgtctgat |
42432176 |
T |
 |
| Q |
301 |
tct |
303 |
Q |
| |
|
||| |
|
|
| T |
42432177 |
tct |
42432179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University