View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9631_high_7 (Length: 229)
Name: NF9631_high_7
Description: NF9631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9631_high_7 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 7 - 229
Target Start/End: Complemental strand, 28396800 - 28396575
Alignment:
| Q |
7 |
tatttgttatt-gctttgtattgtaaataaaatatcacataaaatacataattttgtgtttgattcataga--tagatcaagtagcaacaacaaaaatca |
103 |
Q |
| |
|
||||||||||| |||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| ||||| |
|
|
| T |
28396800 |
tatttgttatttgctttgtattttaaaaaaaatatcacataaaatacataattttgtgtttgattcatataaatagatcaagtagcaacaacaacaatca |
28396701 |
T |
 |
| Q |
104 |
agaaatttaacttcacaattaattaagaatttcttgatggaatgacctagaatttccaaaccgctgattggatcacgtgaatgttatgtcagagctgtct |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28396700 |
agaaatttaacttcacaattaattaagaatttcttgatggaatgacctagaatttccaaaccgctgattggatcacgtgaatgttatgtcagagctgtct |
28396601 |
T |
 |
| Q |
204 |
ggcctctccaatttgattgtctgtca |
229 |
Q |
| |
|
|||||| ||||||||||||||||||| |
|
|
| T |
28396600 |
ggcctccccaatttgattgtctgtca |
28396575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University