View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9631_low_14 (Length: 311)
Name: NF9631_low_14
Description: NF9631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9631_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 17 - 243
Target Start/End: Complemental strand, 25813564 - 25813330
Alignment:
| Q |
17 |
aattataaagattaaaacatcatcagagagttctggaagcatattgttttggtggtttatttcaactacaaaaatatatttgattgaagtttgcttctgc |
116 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |||||||||||||||| |
|
|
| T |
25813564 |
aattataaagattaaaacatcgtcagagagttctggaagcatattgttttggtggtttatttcacctacaaaa-tatatttgagtgaagtttgcttctgc |
25813466 |
T |
|
| Q |
117 |
agggttatcttttttatgtgtgaaagttgttatatgatggatacattttatagttttat---------aattaaggacttgattgttgattatcaatcaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
25813465 |
agggttatcttttttatgtgtgaaagttgttatatgatggatacattttatagttttataagtcagagaattaacgacttgattgttgattatcaatcaa |
25813366 |
T |
|
| Q |
208 |
tacgtttggtatgaaaagttgtgtcaattgatattg |
243 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
25813365 |
tacgtttggtatgaaaaattgtgtcagttgatattg |
25813330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 241 - 302
Target Start/End: Complemental strand, 25813272 - 25813211
Alignment:
| Q |
241 |
ttgtaccctcatgagaaggtgtaattgtttctgttaaaaaataatttaatgtgaacctatgc |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25813272 |
ttgtaccctcatgagaaggtgtaattgtttctgttaaaaaataatttaatgtgaacctatgc |
25813211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University