View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9631_low_23 (Length: 259)
Name: NF9631_low_23
Description: NF9631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9631_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 16 - 254
Target Start/End: Original strand, 49672174 - 49672412
Alignment:
| Q |
16 |
gttacaactatattaagggcagtttttgtccttttagacagtagtgtgtatataatgatttgattctcttttcttttatatgagattttatttgcttcct |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49672174 |
gttacaactatattaagggcagtttttgtccttttagacagtagtgtgtatataatgatttgattctctcttcttttatatgagattttatttgcttcct |
49672273 |
T |
 |
| Q |
116 |
tcgaaccaagcaattgagctcaaatgattataaagacctttttccttgaaaccggaaggttaacaccaaannnnnnncttcgtctcttgtaatgttagga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49672274 |
tcgaaccaagcaattgagctcaaatgattataaagacctttttccttgaaaccggaaggttaacaccaaatttttttcttcgtctcttgtaatgttagga |
49672373 |
T |
 |
| Q |
216 |
cttctcatttgatattattggagccctccctatgcttct |
254 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
49672374 |
cttctcatttgatattattggagccctcctcatgcttct |
49672412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 205 - 242
Target Start/End: Complemental strand, 49291806 - 49291769
Alignment:
| Q |
205 |
taatgttaggacttctcatttgatattattggagccct |
242 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
49291806 |
taatgttaagacttctcatttggtattattggagccct |
49291769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University