View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9631_low_36 (Length: 223)
Name: NF9631_low_36
Description: NF9631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9631_low_36 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 20 - 209
Target Start/End: Complemental strand, 5999213 - 5999024
Alignment:
| Q |
20 |
aacttaaactagaatataggatcaatttacattttgcaaattttgaagcttagccattaccaggattctttcttcaagtcaacattacaggaaaaaggtt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5999213 |
aacttaaactagaatataggatcaatttacattttgcaaattttgaagcttagccattaccaggattctttcttcaagtcaacattacaggaaaaaggtt |
5999114 |
T |
|
| Q |
120 |
atcgaactagatattaaggaacctataacaagaacataagcatcatcaccacatgaataacaatggtatgtcatcccacggtgccctttg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5999113 |
atcgaactagatattaaggaacctataacaagaacataagcatcatcaccacatgaataacaatggtatgtcatcccacggtgccctttg |
5999024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University