View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9631_low_38 (Length: 206)
Name: NF9631_low_38
Description: NF9631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9631_low_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 21 - 134
Target Start/End: Complemental strand, 36592745 - 36592632
Alignment:
| Q |
21 |
cagcgccagcaccggcaggggcagcggcaggaacctctgtggcagccaaagctgcactcattgaggcagcagcaataagaacagcacaagtgaccttcct |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36592745 |
cagcgccagcaccggcaggggcagcggcaggaacctctgtggcagccaaagctgcactcattgaggcagcagcaataagaacagcacaagtgaccttcct |
36592646 |
T |
 |
| Q |
121 |
catgttcatgatga |
134 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36592645 |
catgttcatgatga |
36592632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University