View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9632_low_8 (Length: 294)
Name: NF9632_low_8
Description: NF9632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9632_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 260; Significance: 1e-145; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 17 - 284
Target Start/End: Complemental strand, 12783662 - 12783395
Alignment:
| Q |
17 |
aaaataccatttatgtaaaactactaaggtttcttctactctcgaaacgtgtcagtggacagcacgcaaaactaatcaagtatcaaattaatgtaaccaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12783662 |
aaaataccatttatgtaaaactactaaggtttcttctactctcgaaacgtgtcagtggacagcacgcaaaactaatcaagtatcaaattaatgtaaccaa |
12783563 |
T |
|
| Q |
117 |
ggaacagtgaatggtaatgccttgttgtgtggaggggaccactgagcagcgtgcatgagctgtttgtttccatgcctttgaaaatgttagatcaatcaga |
216 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12783562 |
ggaacagtgaattgtaatgccttgttgtgtggaggggaccactgagcagcgtgcatgagctgtttgtttccatgcctttgaaaatgttagatcaatcaga |
12783463 |
T |
|
| Q |
217 |
tgatgatatatatagttgcacaattatgtgtgcttcttattaaacctgctgctattaccttttctctg |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12783462 |
tgatgatatatatagttgcacaattatgtgtgcttcttattaaacctgctgctgttaccttttctctg |
12783395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 68
Target Start/End: Complemental strand, 12754543 - 12754498
Alignment:
| Q |
23 |
ccatttatgtaaaactactaaggtttcttctactctcgaaacgtgt |
68 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||| ||||||||||| |
|
|
| T |
12754543 |
ccatttatgtaaaagtactaaggtttcctctactatcgaaacgtgt |
12754498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University