View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9633_low_1 (Length: 433)

Name: NF9633_low_1
Description: NF9633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9633_low_1
NF9633_low_1
[»] chr5 (6 HSPs)
chr5 (216-401)||(32552414-32552605)
chr5 (33-110)||(32548882-32548959)
chr5 (258-333)||(32756288-32756363)
chr5 (265-333)||(32750172-32750240)
chr5 (263-350)||(32549064-32549146)
chr5 (259-333)||(32752643-32752718)
[»] chr7 (1 HSPs)
chr7 (307-401)||(45832693-45832783)


Alignment Details
Target: chr5 (Bit Score: 82; Significance: 1e-38; HSPs: 6)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 216 - 401
Target Start/End: Original strand, 32552414 - 32552605
Alignment:
Q  216 atttcattcacatgctacagagtatttcacatacctactttaaaaacaat---------agaatcacactttctc--tcttcatgcaatatcactaacaa 304  Q
    ||||||||||||||||  ||||||||||||| ||||||||||||||||||         |||| ||| |||||||  |||||||| |  |||||||||||    
T  32552414 atttcattcacatgctggagagtatttcacacacctactttaaaaacaatcaaaacactagaaacactctttctctctcttcatgtaccatcactaacaa 32552513  T
Q  305 tctgctttgactactgaggttatgtaaatttgtctcactcagagaagagaatcacaagtaaatcttccctcttttcaattcaccacttttatttcaa 401  Q
    |||||||| |||||| ||||||||||||||||| ||||||     |||||||||||| ||||||| |||||||||||||||||||||||||||||||    
T  32552514 tctgctttcactactcaggttatgtaaatttgtttcactc-----agagaatcacaaataaatctaccctcttttcaattcaccacttttatttcaa 32552605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 33 - 110
Target Start/End: Original strand, 32548882 - 32548959
Alignment:
Q  33 atgactctcttaacctatgttttaatctcatacacgactgtcattctcgcttgatatgcccctaatttgttgtttttt 110  Q
    ||||||| |||||||||||||||||||||||||||   |||||||||| |||||||||||||||||||||||||||||    
T  32548882 atgactcgcttaacctatgttttaatctcatacacagatgtcattctcacttgatatgcccctaatttgttgtttttt 32548959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 258 - 333
Target Start/End: Complemental strand, 32756363 - 32756288
Alignment:
Q  258 aaaacaatagaatcacactttctctcttcatgcaatatcactaacaatctgctttgactactgaggttatgtaaat 333  Q
    |||||| |||||||| |||||||||||||||| | ||||||||||||| |||||| |||||| |||||||||||||    
T  32756363 aaaacactagaatcagactttctctcttcatgtactatcactaacaatatgctttcactactcaggttatgtaaat 32756288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 265 - 333
Target Start/End: Complemental strand, 32750240 - 32750172
Alignment:
Q  265 tagaatcacactttctctcttcatgcaatatcactaacaatctgctttgactactgaggttatgtaaat 333  Q
    |||||||| |||||||||||||||| | |||||||||||||||||||| |||||  |||||||||||||    
T  32750240 tagaatcagactttctctcttcatgtactatcactaacaatctgctttcactacacaggttatgtaaat 32750172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 263 - 350
Target Start/End: Original strand, 32549064 - 32549146
Alignment:
Q  263 aatagaatcacactttctctcttcatgcaatatcactaacaatctgctttgactactgaggttatgtaaatttgtctcactcagagaa 350  Q
    |||||||||||||||| |||||| ||| | |||||||||||||||||     ||||| || |||||||||||| ||||||||||||||    
T  32549064 aatagaatcacactttttctcttgatgtactatcactaacaatctgc-----ctactcagattatgtaaatttatctcactcagagaa 32549146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 259 - 333
Target Start/End: Complemental strand, 32752718 - 32752643
Alignment:
Q  259 aaacaatagaatcacactttctctcttcatgcaatatcactaacaatctgc-tttgactactgaggttatgtaaat 333  Q
    ||||| |||||||| |||||||||||||||| | ||||||||||||| | | ||| |||||| ||||||| |||||    
T  32752718 aaacactagaatcagactttctctcttcatgtactatcactaacaatttccttttcactacttaggttatttaaat 32752643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 307 - 401
Target Start/End: Complemental strand, 45832783 - 45832693
Alignment:
Q  307 tgctttgactactgaggttatgtaaatttgtctcactcagagaagagaatcacaagtaaatcttccctcttttcaattcaccacttttatttcaa 401  Q
    |||||| |||||| ||||||||||||||| | |||||     ||||||||||||| |||||||  ||||||||||||||||||||| ||||||||    
T  45832783 tgctttcactacttaggttatgtaaatttatttcact----aaagagaatcacaaataaatctatcctcttttcaattcaccacttatatttcaa 45832693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University