View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9633_low_6 (Length: 202)

Name: NF9633_low_6
Description: NF9633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9633_low_6
NF9633_low_6
[»] chr6 (1 HSPs)
chr6 (9-55)||(1432804-1432850)


Alignment Details
Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 9 - 55
Target Start/End: Complemental strand, 1432850 - 1432804
Alignment:
9 agaacctgtgtagaagctatgtcaagcaatcaaaccaggtggaataa 55  Q
    |||| ||||| ||||||||||||||||||||||||||||||||||||    
1432850 agaatctgtgaagaagctatgtcaagcaatcaaaccaggtggaataa 1432804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University