View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9636_low_6 (Length: 276)
Name: NF9636_low_6
Description: NF9636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9636_low_6 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 18 - 276
Target Start/End: Complemental strand, 16917298 - 16917040
Alignment:
| Q |
18 |
aagttttgggtacaactggtgttgttcttagtgttatctttggttctagcgctgttttgcttactcttaatgctattttagctgaactttctgataaagt |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16917298 |
aagttttgggcacaactggtgttgttcttagtgttatctttggttctagcgctgttttgcttactcttaatgctattttagctgaactttctgataaagt |
16917199 |
T |
 |
| Q |
118 |
ttttgctggcaaaggggttcaagatttcttcacatgatcgatcattcactattatattgttgtagattcaactattaatttcttgtctttcatttttgtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16917198 |
ttttgctggcaaaggggttcaagatttcttcacatgatcgatcattcactattatattgttgtagattcaactattaatttcttgtctttcatttttgtt |
16917099 |
T |
 |
| Q |
218 |
tctgttatgttttaaagaaattcaattttgtgcgaataattggttattgatcaagttgc |
276 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
16917098 |
tctgttatgttttaaagaaattaaattttgtgcaaataattggttattgatcaagttgc |
16917040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University