View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9638_low_1 (Length: 461)
Name: NF9638_low_1
Description: NF9638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9638_low_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 302; Significance: 1e-170; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 134 - 447
Target Start/End: Original strand, 14538966 - 14539279
Alignment:
| Q |
134 |
atcactttatatataaaaccaatcaatgaacattcataatcatacacacaaagtaacatttatacaagtgagtgagaatcttaccggtggtctactgtga |
233 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14538966 |
atcactttatatataaaaccaatcaatgatcattcataatcatacacacaaagtaccatttatacaagtgagtgagaatcttaccggtggtctactgtga |
14539065 |
T |
|
| Q |
234 |
caaacagaatcatggtcgtctatggtggtggtcctggtgcactgcttctcagagctggtgttatccatagaagctattgaagttgaagtgaaaccagtca |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14539066 |
caaacagaatcatggtcgtctatggtggtggtcctggtgcactgcttctcagagctggtgttatccatagaagctattgaagttgaagtgaaaccagtca |
14539165 |
T |
|
| Q |
334 |
taccaaattccctatcgtacgtatcaagtgtcacttgttggctctgcctcccaaaggttgcactgccactcatactttggtccctaccgctccccgccac |
433 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14539166 |
taccaaattccctatcgtacgtatcaagtgtcacttgctggctctgcctcccaaaggttgcactgccactcatactttggtccctaccgctccccgccac |
14539265 |
T |
|
| Q |
434 |
gtgtgccaccctcc |
447 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
14539266 |
gtgtgccaccctcc |
14539279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 18 - 111
Target Start/End: Original strand, 14538810 - 14538903
Alignment:
| Q |
18 |
atttaggcatatatattgtaaaatctttttacaaattaacacaaaacatagtaagatttatactcttggtgcatagagatttatacaaaatata |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14538810 |
atttaggcatatatattgtaaaatctttttaaaaattaacacaatacatagtaagatttatagcgttggtgcatagagatttatacaaaatata |
14538903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University