View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9639_low_18 (Length: 262)
Name: NF9639_low_18
Description: NF9639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9639_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 3 - 252
Target Start/End: Original strand, 28430956 - 28431209
Alignment:
| Q |
3 |
ataatcgaccgaaatttgaactcaagttcaattaagatagaattaattccaatcactcgagttcggttgttacatgattactagatccctctaaaaacta |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28430956 |
ataatcgaccgaaatttgaactcaagttcaattaagatagaattaactccaatcactcgagttcggttgttacatgattactagatccctctaaagacta |
28431055 |
T |
 |
| Q |
103 |
acgaaatnnnnnnnnn--ttacatgaaggtgacaatacatttattt--attagcttgaaaccaaacacatttataatgtctccttctttctatttaggct |
198 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28431056 |
acgaaataaataaaaaatttacatgaaggtgaccatacatttatttttattagcttgaaaccaaacacatttataatgtctccttctttttatttaggct |
28431155 |
T |
 |
| Q |
199 |
gcaacgggcaccttggatggtatcgttgacacagtttccgccgtccatcctttg |
252 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
28431156 |
gcaacgggcaccttggatggtatcattgacacagtttctgccgtccatcctttg |
28431209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University