View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9639_low_29 (Length: 226)
Name: NF9639_low_29
Description: NF9639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9639_low_29 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 16 - 219
Target Start/End: Original strand, 3317099 - 3317301
Alignment:
| Q |
16 |
gctgctatgtcttctcttaatataaacccaaatcccaatcgatttgatcaaaaatcaaactacacctacctgtaattctcagatcactcaaaaagtttgt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
3317099 |
gctgctatgtcttctcttaatataaacccaaatcccaatcgatttgatcaaaaatcaaactacaccaacctgtaattctcagatcactcgaaaagtttgt |
3317198 |
T |
|
| Q |
116 |
tttctttaattttgatgtgcatctcataggctgataaggtttacgtcatcttcttgtgtttctctaatcattttatgtttattttagatttttggccttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
3317199 |
tttctttaattttgatgtgcatctcataggctgatagggtttacgtc-tcttcttgtgtttctctaatcattttatgtttattttagatttttggctttt |
3317297 |
T |
|
| Q |
216 |
gctt |
219 |
Q |
| |
|
|||| |
|
|
| T |
3317298 |
gctt |
3317301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University