View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9641_low_18 (Length: 250)
Name: NF9641_low_18
Description: NF9641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9641_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 91 - 238
Target Start/End: Original strand, 46540583 - 46540730
Alignment:
| Q |
91 |
aaaaacgaacaattacattttaaggttcttttataattcttcttcaatactctctatgaagcgttttctacttctgaaaccatgaaaagatgtagaattt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46540583 |
aaaaacgaacaattacattttaaggttcttttataattcttcttcaatactctctatgaagcgttttctacttctgaaaccatgaaaagatgtagaattt |
46540682 |
T |
|
| Q |
191 |
catcatggtattataagccattttttccttcgtctatgcagatgatgt |
238 |
Q |
| |
|
||||||||||| ||||||| ||||||||||| |||||||||| ||||| |
|
|
| T |
46540683 |
catcatggtatcataagccgttttttccttcttctatgcagacgatgt |
46540730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 46540455 - 46540520
Alignment:
| Q |
1 |
tgtgtattaattagggttaatatatgtttacacccctaagcgacttttggtttaccaaagtttaga |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46540455 |
tgtgtattaattagggttaatatatgtttacacccctaagcgacttttggtttaccaaagtttaga |
46540520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University