View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9642_low_1 (Length: 240)
Name: NF9642_low_1
Description: NF9642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9642_low_1 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 14504830 - 14504607
Alignment:
| Q |
1 |
ctatgagttttaagtctgtggtgcagaagctaactggtaagcattcttctgatcgtagtgttgatgatgaagctagagatggtagaaaagctaagaggga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14504830 |
ctatgagttttaagtctgtggtgcagaagctaactggtaagcattcttctgatcgtagtgttgatgatgatgctagagatggtagaaaagctaagaggga |
14504731 |
T |
|
| Q |
101 |
aaagcataatttaagtgggtttgatcatgtgccagctagtgaaaatgttgatgatggaagaagcacnnnnnnnataagtgattcattgtttaatgagtat |
200 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
14504730 |
aaagcacaatttaagtgggtttgatgatgtgcctgctagtgaaaatgttgatgatggaagaagcactttttttataagtgattcattgtttaatgagtat |
14504631 |
T |
|
| Q |
201 |
gatatgtttcttagagagaagatg |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
14504630 |
gatatgtttcttagagagaagatg |
14504607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 144 - 208
Target Start/End: Complemental strand, 14497070 - 14497006
Alignment:
| Q |
144 |
aatgttgatgatggaagaagcacnnnnnnnataagtgattcattgtttaatgagtatgatatgtt |
208 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14497070 |
aatgttgatgatggaagaagcactttttttataagtgattcattgtttaatgagtatgatatgtt |
14497006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 14497177 - 14497130
Alignment:
| Q |
1 |
ctatgagttttaagtctgtggtgcagaagctaactggtaagcattctt |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14497177 |
ctatgagttttaagtctgtggtgcagaagctaactggtaagcactctt |
14497130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University