View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9643_low_13 (Length: 250)
Name: NF9643_low_13
Description: NF9643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9643_low_13 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 39 - 250
Target Start/End: Original strand, 35074370 - 35074580
Alignment:
| Q |
39 |
ttatatttattagcaataaaagccactgttataagcgataaaagcctcccccgtgtgttgttatatttatcagttacaaattgtagggttatattatcat |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35074370 |
ttatatttattagcaataaaagccactgttataagcgataaaagcctcccccgtgcgttgttatatttatcagttacaaattgtagggttatattatcat |
35074469 |
T |
 |
| Q |
139 |
tatgttccttcnnnnnnnnntcattatgtcactagcttaaccaaagtcctgaattcgaatctagctttagatgtgcaacaccattcaaacttttagggga |
238 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| | |
|
|
| T |
35074470 |
tatgttccttc-aaaaaaaatcattatgtcactagcttaaccaaagtcctgagttcgaatctagctttagatgtgcaacaccgttcaaacttttagggaa |
35074568 |
T |
 |
| Q |
239 |
agtttgtcgtcc |
250 |
Q |
| |
|
|||||||||||| |
|
|
| T |
35074569 |
agtttgtcgtcc |
35074580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University