View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9643_low_18 (Length: 218)
Name: NF9643_low_18
Description: NF9643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9643_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 18 - 135
Target Start/End: Complemental strand, 25244805 - 25244686
Alignment:
| Q |
18 |
gaagaagatgatgaaaatatgaggaaaaataaaaagagggaagcaaannnnnnnnnnnnnnnnnngacaaaagagggaagc--aaatattaggaggtgag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| ||||||| ||||||||| |
|
|
| T |
25244805 |
gaagaagatgatgaaaatatgaggaaaaataaagagagggaagcaaatatttatttttattttttgacaaaagagggaagcaaaaatattgggaggtgag |
25244706 |
T |
|
| Q |
116 |
aaagatatactgagagaaat |
135 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
25244705 |
aaagatatactgagagaaat |
25244686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University