View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9643_low_4 (Length: 360)
Name: NF9643_low_4
Description: NF9643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9643_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 4e-66; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 13887902 - 13888037
Alignment:
| Q |
1 |
ttcgataatacatttttctcctttctattcactttacttctctcattttgagtttcttattatggtatcagaagccttctctttggagaaggtggttacg |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13887902 |
ttcgataatacatttttcccctttctattcactttacttctctcattttgagtttcttattatggtatcagaagccttctctttggagaaggtggttacg |
13888001 |
T |
|
| Q |
101 |
attaagttacgcatcatttccgccatggatgcgtga |
136 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13888002 |
attaagttacgcatcatttccgcaatggatgcgtga |
13888037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 231 - 345
Target Start/End: Original strand, 13888135 - 13888249
Alignment:
| Q |
231 |
gtgttgattcctgaatcttccattcnnnnnnnattcttcaccgatcaaatgatggtacataatcaagatccaacacaagatctctcttcaccttactatg |
330 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13888135 |
gtgttgattcctgaatcttccattctttttttattcttcaccgatcaaatgatggtgcgtaatcaagatccaacacaagatctctcttcaccttactatg |
13888234 |
T |
|
| Q |
331 |
ttcatcccagtgatg |
345 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
13888235 |
ttcatcccagtgatg |
13888249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 5 - 62
Target Start/End: Original strand, 13892562 - 13892619
Alignment:
| Q |
5 |
ataatacatttttctcctttctattcactttacttctctcattttgagtttcttatta |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13892562 |
ataatacatttttctcctttctattcactttacttctctcattttgagtttcttatta |
13892619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 53 - 134
Target Start/End: Complemental strand, 11021606 - 11021525
Alignment:
| Q |
53 |
tttcttattatggtatcagaagccttctctttggagaaggtggttacgattaagttacgcatcatttccgccatggatgcgt |
134 |
Q |
| |
|
||||||| |||||||||||||| |||||||| |||||||| ||||||||| |||||||| || ||||||||||||||||| |
|
|
| T |
11021606 |
tttcttaatatggtatcagaagtcttctcttgagagaaggttgttacgattcagttacgcttctcttccgccatggatgcgt |
11021525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 47 - 136
Target Start/End: Original strand, 15094995 - 15095084
Alignment:
| Q |
47 |
tttgagtttcttattatggtatcagaagccttctctttggagaaggtggttacgattaagttacgcatcatttccgccatggatgcgtga |
136 |
Q |
| |
|
||||||||| |||||| |||||| ||||||||||||| | |||||||||| |||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
15094995 |
tttgagtttgttattagggtatccgaagccttctcttggtagaaggtggtcacgattcagttacgcatcatttccgcaatggatgcgtga |
15095084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 290 - 345
Target Start/End: Original strand, 15095214 - 15095269
Alignment:
| Q |
290 |
taatcaagatccaacacaagatctctcttcaccttactatgttcatcccagtgatg |
345 |
Q |
| |
|
|||||||||| ||| ||||||||| |||||||| || ||||||||||||||||||| |
|
|
| T |
15095214 |
taatcaagattcaatacaagatctttcttcaccctattatgttcatcccagtgatg |
15095269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 15 - 62
Target Start/End: Complemental strand, 12147352 - 12147303
Alignment:
| Q |
15 |
tttctcctttctattcactttacttctctc--attttgagtttcttatta |
62 |
Q |
| |
|
|||||||||||||||||||| | ||||||| |||||||||||||||||| |
|
|
| T |
12147352 |
tttctcctttctattcacttcatttctctctcattttgagtttcttatta |
12147303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University