View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9645_low_10 (Length: 202)
Name: NF9645_low_10
Description: NF9645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9645_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 16 - 188
Target Start/End: Complemental strand, 43284970 - 43284798
Alignment:
| Q |
16 |
acatcaactgccttttcaccgcaccaacataaattttagagttcattcaagcgccaaaacaagtgagaaccctaacaaagcactagcatgtgatcgagct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43284970 |
acatcaactgccttttcaccgcaccaacataaattttagagttcattcaagcgccaaaacaagtgagaaccctaacaaagcactagcatgtgatcgagct |
43284871 |
T |
 |
| Q |
116 |
tgttcgattaaattattaaaatatatcatcagtcatcacacccaaggtttaatcaaactaaagatctgtgctc |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43284870 |
tgttcgattaaattattaaaatatatcatcagtcatcacacccaaggtttaatcaaactaaagatctgtgctc |
43284798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University