View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9645_low_3 (Length: 258)
Name: NF9645_low_3
Description: NF9645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9645_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 56 - 251
Target Start/End: Original strand, 3647801 - 3647996
Alignment:
| Q |
56 |
gaatgagcaagagaattgggggttcattgcttattatattacataacttgctttacttatggagttaagattcactagggttgatagttatgtatgtact |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3647801 |
gaatgagcaagagaattgggggttcattgcttattatattacataacttgctttacttatggagtaaagattcactagggttgatagttatgtatgtact |
3647900 |
T |
 |
| Q |
156 |
atgaagatgttgaactactgtnnnnnnntggccatgcctatagctttgaatctgatgcttcacaaaatcactgatgtactcatccttgtctctgtg |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3647901 |
atgaagatgttgaactactgtaaaaaaatggccatgcctatagctttgaatctgatgcttcacaaaatcactgatgtactcatccttgtctctgtg |
3647996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University