View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9645_low_4 (Length: 258)

Name: NF9645_low_4
Description: NF9645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9645_low_4
NF9645_low_4
[»] chr4 (1 HSPs)
chr4 (56-251)||(3647801-3647996)


Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 56 - 251
Target Start/End: Original strand, 3647801 - 3647996
Alignment:
56 gaatgagcaagagaattgggggttcattgcttattatattacataacttgctttacttatggagttaagattcactagggttgatagttatgtatgtact 155  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
3647801 gaatgagcaagagaattgggggttcattgcttattatattacataacttgctttacttatggagtaaagattcactagggttgatagttatgtatgtact 3647900  T
156 atgaagatgttgaactactgtnnnnnnntggccatgcctatagctttgaatctgatgcttcacaaaatcactgatgtactcatccttgtctctgtg 251  Q
    |||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3647901 atgaagatgttgaactactgtaaaaaaatggccatgcctatagctttgaatctgatgcttcacaaaatcactgatgtactcatccttgtctctgtg 3647996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University