View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9646_low_5 (Length: 241)
Name: NF9646_low_5
Description: NF9646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9646_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 18 - 228
Target Start/End: Complemental strand, 55738568 - 55738358
Alignment:
| Q |
18 |
ccttcttgtcatccataatatgatcagcaactgcattttacaatactgctttaattaatgctttggatactttgatgtcaaaataatcttttaaagtctg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55738568 |
ccttcttgtcatccataatatgatcagcaactgcattttacaatactgctttaattaatgctttggatactttgatgtcaaaataatcttttaaagtctg |
55738469 |
T |
|
| Q |
118 |
atgattaaattaaagttaaattcataatcagagatgcataccccaaacacagacaacaccattttctctgcgaaagatatgggacctgcaaaaaccaatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55738468 |
atgattaaattaaagttaaattcataatcagagatgcataccccaaacacagacaacaccattttctctgcgaaagatatgggacctgcaaaaaccaatt |
55738369 |
T |
|
| Q |
218 |
acagaattatc |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
55738368 |
acagaattatc |
55738358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University