View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9647_low_7 (Length: 238)
Name: NF9647_low_7
Description: NF9647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9647_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 5e-46; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 110 - 219
Target Start/End: Original strand, 18325095 - 18325204
Alignment:
| Q |
110 |
caatattttatgtatgaagtaatggctaggaaagtgaagcagccgatggatgatactgatggaaaatatggaattgataacgatgaaaattatcatgttg |
209 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18325095 |
caatattttatgtatgatgtaatggctaggaaggtgaagcagccgatggatgatactgatggaaaatatggaattgataatgatgaaaattatcatgttg |
18325194 |
T |
|
| Q |
210 |
tgtctctgaa |
219 |
Q |
| |
|
||||| |||| |
|
|
| T |
18325195 |
tgtctttgaa |
18325204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 110 - 219
Target Start/End: Complemental strand, 18440302 - 18440193
Alignment:
| Q |
110 |
caatattttatgtatgaagtaatggctaggaaagtgaagcagccgatggatgatactgatggaaaatatggaattgataacgatgaaaattatcatgttg |
209 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18440302 |
caatattttatgtatgatgtaatggctaggaaggtgaagcagccgatggatgatactgatggaaaatatggaattgataatgatgaaaattatcatgttg |
18440203 |
T |
|
| Q |
210 |
tgtctctgaa |
219 |
Q |
| |
|
||||| |||| |
|
|
| T |
18440202 |
tgtctttgaa |
18440193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 11 - 43
Target Start/End: Complemental strand, 18440402 - 18440370
Alignment:
| Q |
11 |
tagattattctgattctagattgttaaagggat |
43 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
18440402 |
tagatttttctgattctagattgttaaagggat |
18440370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University