View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9648_high_1 (Length: 368)
Name: NF9648_high_1
Description: NF9648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9648_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 104 - 351
Target Start/End: Complemental strand, 7915120 - 7914874
Alignment:
| Q |
104 |
caatttgctttctctatgcagagctatagctccaaaatcagcaactttaaaagctaatgcagagctacagatccgccaagatgattgttccgataggcat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7915120 |
caatttgctttctctatgcagagctatagctccaaaatcagcaactttaaaagccaatgcagagctacagatccgccaagatgattgttccgataggcat |
7915021 |
T |
 |
| Q |
204 |
caagaggcatctactaataatttagtctgttgagaaaataacagtaaccaattccaattctttcacccaattagtaaacacttagtaacgtcgttgcctc |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7915020 |
caagaggcatctactaataatttagtctgttgagaaaataacagtaaccaattccaattctttcacccaattagt-aacacttagtaacgtcgttgcctc |
7914922 |
T |
 |
| Q |
304 |
gccgatcgacattgtaactagtggttccgaccacaaggttttcgttcc |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7914921 |
gccgatcgacattgtaactagtggttccgaccacaaggttttcgttcc |
7914874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 18 - 91
Target Start/End: Original strand, 8361318 - 8361391
Alignment:
| Q |
18 |
gaacaagtataaattgatca-ttatgaataagtgaaccttacaaagctttataagtgtgaatctgactaagatag |
91 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| ||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
8361318 |
gaacaagtataaattgatcaattataaataattgaaccttacaaagctt-ataagtgtgaatcttactaagatag |
8361391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 19 - 68
Target Start/End: Original strand, 8411393 - 8411442
Alignment:
| Q |
19 |
aacaagtataaattgatcattatgaataagtgaaccttacaaagctttat |
68 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8411393 |
aacaagtataaattgatcattataaataagtgaaccttacaaagctttat |
8411442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 100 - 135
Target Start/End: Original strand, 8410542 - 8410577
Alignment:
| Q |
100 |
ccagcaatttgctttctctatgcagagctatagctc |
135 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8410542 |
ccagcaattcgctttctctatgcagagctatagctc |
8410577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University