View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9648_high_2 (Length: 330)
Name: NF9648_high_2
Description: NF9648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9648_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 3e-70; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 88 - 222
Target Start/End: Original strand, 10363982 - 10364116
Alignment:
| Q |
88 |
attgagctatatggaaactagtgataatgtctcaatctcaaggttgttgttccagtagcagcagtggtaacagatctgatgcttctggagtagctgaatt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10363982 |
attgagctatatggaaactagtgataatgtctcaatctcaaggttgttgttccagtagcagcagtggtaacagatctgatgcttctggagtagctgaatt |
10364081 |
T |
|
| Q |
188 |
gaagctgtatagagcttttatattctctgtaccaa |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
10364082 |
gaagctgtatagagcttttatattctctgtaccaa |
10364116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 269 - 322
Target Start/End: Original strand, 10364163 - 10364216
Alignment:
| Q |
269 |
gagaccaagaagggttgattggtcttctattaggatgaggtctgtttctgtgct |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10364163 |
gagaccaagaagggttgattggtcttctattaggatgaggtctgtttctgtgct |
10364216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 23 - 58
Target Start/End: Original strand, 10363874 - 10363909
Alignment:
| Q |
23 |
aacttcaacattaaacttgttatgaatgtgttaatt |
58 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10363874 |
aacttcaatattaaacttgttatgaatgtgttaatt |
10363909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University