View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9648_high_6 (Length: 246)
Name: NF9648_high_6
Description: NF9648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9648_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 17 - 234
Target Start/End: Original strand, 41173060 - 41173277
Alignment:
| Q |
17 |
cctgtgctttatataaatccataaaagtgactaatggaattaaattgaattaatagtgcagtnnnnnnnntagttatagtataagtcatcaagcaatttg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
41173060 |
cctgtgctttatataaatccataaaagtgactaatggaattaaattgagttaatagtgcagtaaaaaaaatagttatagtataaatcatcaagcaatttg |
41173159 |
T |
 |
| Q |
117 |
gcatgactctatgtgaggcaaatcattttgtattcttctaccacttttcccctagacattgcatttactagattggcaatgatagagctacgatccagaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41173160 |
gcatgactctatgtgaggcaaatcattttgtattcttctaccacttttcccctagacgttgcatttactagattggcaatgatagagctacgatccagaa |
41173259 |
T |
 |
| Q |
217 |
ttttaagttgcctatgct |
234 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
41173260 |
ttttaagttgcctatgct |
41173277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University