View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9648_low_20 (Length: 244)
Name: NF9648_low_20
Description: NF9648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9648_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 30 - 242
Target Start/End: Original strand, 40753739 - 40753950
Alignment:
| Q |
30 |
gagcttgtgcataaccaatggttaattggtgtaataagaagnnnnnnnngtccttagctaggtctccattggcagcgtgtccttaaacatgcaccaagaa |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40753739 |
gagcttgtgcataaccaatggttaattggtgtaataagaagaaaaaaaattccttagctaggtctccattggtagcgtgtccttaaacatgcaccaagaa |
40753838 |
T |
 |
| Q |
130 |
aaggcaaagcatttttaaattgcttaacaagattacaaaacgagattgtatttaactttttcccttaaaataaagggaaatgtattcgagggctccaaga |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |||||||||||||||| | ||| | ||||||||| ||||| |
|
|
| T |
40753839 |
aaggcaaagcatttttaaattgcttaacaagattaggaaacgagattgtattcaactctttcccttaaaataaaagaaaagattttcgagggc-ccaagg |
40753937 |
T |
 |
| Q |
230 |
cactctttaaaca |
242 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40753938 |
cactctttaaaca |
40753950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University