View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9648_low_24 (Length: 222)

Name: NF9648_low_24
Description: NF9648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9648_low_24
NF9648_low_24
[»] chr5 (1 HSPs)
chr5 (2-203)||(39016973-39017175)


Alignment Details
Target: chr5 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 2 - 203
Target Start/End: Original strand, 39016973 - 39017175
Alignment:
2 aataaaacattaatgaccaaccaaaaagtgatatataaaccaaataattaactactttttgacaaacnnnnnnnnn-tgcttgcttgtaaaataaagaat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||||||    
39016973 aataaaacattaatgaccaaccaaaaagtgatatataaaccaaataattaactactttttgacaaacaaaaaaaaaatgcttgcttgtaaaataaagaat 39017072  T
101 gtgcaactaacagacataaagaatgattattgcaaagcacaatgagggagcattaaaatggaagaacaaaggagttaaatgcagacttgaatatgactag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39017073 gtgcaactaacagacataaagaatgattattgcaaagcacaatgagggagcattaaaatggaagaacaaaggagttaaatgcagacttgaatatgactag 39017172  T
201 aac 203  Q
    |||    
39017173 aac 39017175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University