View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9649_low_16 (Length: 293)
Name: NF9649_low_16
Description: NF9649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9649_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 20 - 280
Target Start/End: Complemental strand, 32432003 - 32431747
Alignment:
| Q |
20 |
aggcatacgtggccatggaccattatcaaatgcttctcttgcagctttcacagcaatatcaacatcttctttggtagcttctgctatttttgtaatcact |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32432003 |
aggcatacgtggccatggaccattatcaaatgcttctctagcagctttcacagcaatatcaacatcatctttggtagcttctgctatttttgtaatcact |
32431904 |
T |
 |
| Q |
120 |
tcttctgttcttggatcaatagtctcaaaagnnnnnnnnnnnnnnatttcaacaaacaaaaaattcaatatgcatataagtatatcaagtcaattaaaac |
219 |
Q |
| |
|
||||||||||||||||||| ||||||||| | ||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32431903 |
tcttctgttcttggatcaacagtctcaaacgtttttcctttttttatttc----aacaaaaaattcaatatgcatataagtatatcaagtcaattaaaac |
32431808 |
T |
 |
| Q |
220 |
tttgtaaccaaaatagtcaatttttatttttaaaaatttggaccattacccctatatatct |
280 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32431807 |
tttgtgaccaaaatagtcaatttttatttttaaaaatttggaccattacccctatatatct |
32431747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University