View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9649_low_18 (Length: 287)
Name: NF9649_low_18
Description: NF9649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9649_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 15 - 271
Target Start/End: Complemental strand, 44829337 - 44829081
Alignment:
| Q |
15 |
aacctgtgagaactatcaggatgccaagcatcaacaggttacctccatatacgtcttggatacatttagccaggtgtgtttgacttataaatttcaatga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44829337 |
aacctgtgagaactatcaggatgccaagcatcaacaggttacctccatatacgtcttggatacatttagccaggtgtgtttgaattataaatttcaatga |
44829238 |
T |
 |
| Q |
115 |
catgttgtgaatcctattacatgaaaatttttaggaagtgaaagtgtatgtttaatatgcatttgatgtcaaatgttattgatcaatctatgttaaattt |
214 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44829237 |
catgttgtgaatcctcttacatgaaaatttttaggaagtgaaagtgtatgtttaatatgcatttgatgtcaaatgttattgatcaatctatgttaaattt |
44829138 |
T |
 |
| Q |
215 |
gtgtcgtctatttactactttttgaaaacatttcttgcaaaatagaaatgaaaaaat |
271 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44829137 |
gtgtcgtctatttactactttctgaaaacatttcttgcaaaatagaaatgaaaaaat |
44829081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University