View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9649_low_23 (Length: 246)
Name: NF9649_low_23
Description: NF9649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9649_low_23 |
 | |
|
| [»] scaffold0053 (1 HSPs) |
| |
|
| [»] scaffold0239 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0053 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: scaffold0053
Description:
Target: scaffold0053; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 246
Target Start/End: Complemental strand, 74488 - 74260
Alignment:
| Q |
18 |
tgaattatgtaatgtttgtaaagtagatgaaaattatagatgcaaataaattttatattgtgtgtatttagaaatcacatatgtttttaaactgatatta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
74488 |
tgaattatgtaatgtttgtaaagtagatgaaaattatagatgcaaataaattttgtattgtgtgtatttagaaatcacatatggttttaaactgatattg |
74389 |
T |
|
| Q |
118 |
cagttaccttaagaattttgattttgcacaaaatgcagacaaatatgattaatgcatccataattgtgatgatacgctaatttccttgcatttagttgtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
74388 |
cagttaccttaagaattttgattttgcacaaaatgcagacaaatatgattgatgcatccataattgtgatgatacgctaatttccttgcatttagttgtt |
74289 |
T |
|
| Q |
218 |
agattctcaattttgtttatggacttgtc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
74288 |
agattctcaattttgtttatggacttgtc |
74260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0239 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: scaffold0239
Description:
Target: scaffold0239; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 246
Target Start/End: Complemental strand, 2733 - 2505
Alignment:
| Q |
18 |
tgaattatgtaatgtttgtaaagtagatgaaaattatagatgcaaataaattttatattgtgtgtatttagaaatcacatatgtttttaaactgatatta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
2733 |
tgaattatgtaatgtttgtaaagtagatgaaaattatagaagcaaataaattttgtattgtgtgtatttagaaatcgcatatggttttaaactgatattg |
2634 |
T |
|
| Q |
118 |
cagttaccttaagaattttgattttgcacaaaatgcagacaaatatgattaatgcatccataattgtgatgatacgctaatttccttgcatttagttgtt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2633 |
cagttaccttaagaattttgattttgcacaaaatgcagaaaaatatgattgatgcattcataattgtgatgatacgctaatttccttgcatttagttgtt |
2534 |
T |
|
| Q |
218 |
agattctcaattttgtttatggacttgtc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2533 |
agattctcaattttgtttatggacttgtc |
2505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University