View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9649_low_31 (Length: 209)
Name: NF9649_low_31
Description: NF9649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9649_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 33 - 191
Target Start/End: Complemental strand, 34024086 - 34023928
Alignment:
| Q |
33 |
gataaacacattcaatgctatatagatactttaatacttaaataacaattctatttatctatggtccttaaacaatcacgatcaattaattgcaaaggta |
132 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
34024086 |
gataaacacatacaatgctatatagatactttaatacttaaataacaattctatttatctatggtccttaaacaatcacgctcaattaattacaaaggta |
34023987 |
T |
 |
| Q |
133 |
taagcatgaggtgattatttgtaagaaagtgagccaacaataccattttgtgcaacctt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34023986 |
taagcatgaggtgattatttgtaagaaagtgagccaacaataccattttgtgcaacctt |
34023928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University