View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9650_low_32 (Length: 224)
Name: NF9650_low_32
Description: NF9650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9650_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 7 - 207
Target Start/End: Original strand, 364007 - 364197
Alignment:
| Q |
7 |
aagaataaaagaagaggtttgtgaaattatgatttcatgtatattgtatttgagtcacactatacaaaggtttatatacacatgttacttgaaaaacaag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
364007 |
aagaataaaagaagaggtttgtgaaattatgatttcatgtatattgtatttgagtcacactatacaaaggtttatatacacatgttacttgaaaaacaag |
364106 |
T |
|
| Q |
107 |
tagttttccaaactgtaacaaactatacaccgtaaatggcttataacaaaccataaattgctattgctaaccgtaagtaactattgcaactaacttgaat |
206 |
Q |
| |
|
| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
364107 |
ttgttttc----------caaactatacaccgtaaatggcttataacaaaccataaattgctattgctaaccgtaagtaactattgcaactaacttgaat |
364196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University