View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9650_low_34 (Length: 222)
Name: NF9650_low_34
Description: NF9650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9650_low_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 51286210 - 51286410
Alignment:
| Q |
1 |
tatgagttgtcctacatactagtggttaacgtcctctctatattcattcataattgtttctaattattccatttaaagagatcatatcataataaaacct |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
51286210 |
tatgagttgtcctacatagtagtggttaacgtcctctctatattcat----aattctttctaattattccatttaaagagataatatcataataaaacct |
51286305 |
T |
|
| Q |
101 |
aaaaataattaatgatgggttattatcta-ttttttgtacatagcaaagatcataactccattaggttcaaaaagatctcaatactcagtaatccctaat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
51286306 |
aaaaataattaatgatgggttattatctatttttttgtacatagcaaagatcataactccattaggttcaaaaagatctcaatactcattaatccctaat |
51286405 |
T |
|
| Q |
200 |
aaatg |
204 |
Q |
| |
|
||||| |
|
|
| T |
51286406 |
aaatg |
51286410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University