View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9651_low_31 (Length: 216)
Name: NF9651_low_31
Description: NF9651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9651_low_31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 9658616 - 9658417
Alignment:
| Q |
1 |
gttgctgatggtgacaacaagctcggaattaggtaattcagatgctcagtatcttgattcaggttcttcatatcacatgactggccatacagaatggtta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || ||||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9658616 |
gttgctgatggtgacaacaagctcggaattaggtaattcagatacttggtatcttgactcaggttcttcatatcacatgactggccatagagaatggtta |
9658517 |
T |
|
| Q |
101 |
gtggattttgatgaaaacaagagaagaaaagtgagacttgcagataataaaacagttccagctgaaggaacaagaaatatagtgatcaataccaaagaag |
200 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9658516 |
gtggattttgatgaaaacgagagaagaaatgtgagacttgcagataataaaacagttccagctgaaggaacaagaaatacagtgatcaataccaaagaag |
9658417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 99
Target Start/End: Original strand, 18192401 - 18192451
Alignment:
| Q |
49 |
gtatcttgattcaggttcttcatatcacatgactggccatacagaatggtt |
99 |
Q |
| |
|
||||||||||||||| | |||| ||||||||||||| |||| ||||||||| |
|
|
| T |
18192401 |
gtatcttgattcaggatgttcaaatcacatgactggtcatagagaatggtt |
18192451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University