View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9651_low_31 (Length: 216)

Name: NF9651_low_31
Description: NF9651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9651_low_31
NF9651_low_31
[»] chr3 (1 HSPs)
chr3 (1-200)||(9658417-9658616)
[»] chr8 (1 HSPs)
chr8 (49-99)||(18192401-18192451)


Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 9658616 - 9658417
Alignment:
1 gttgctgatggtgacaacaagctcggaattaggtaattcagatgctcagtatcttgattcaggttcttcatatcacatgactggccatacagaatggtta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||  ||||||||| ||||||||||||||||||||||||||||||| ||||||||||    
9658616 gttgctgatggtgacaacaagctcggaattaggtaattcagatacttggtatcttgactcaggttcttcatatcacatgactggccatagagaatggtta 9658517  T
101 gtggattttgatgaaaacaagagaagaaaagtgagacttgcagataataaaacagttccagctgaaggaacaagaaatatagtgatcaataccaaagaag 200  Q
    |||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
9658516 gtggattttgatgaaaacgagagaagaaatgtgagacttgcagataataaaacagttccagctgaaggaacaagaaatacagtgatcaataccaaagaag 9658417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 99
Target Start/End: Original strand, 18192401 - 18192451
Alignment:
49 gtatcttgattcaggttcttcatatcacatgactggccatacagaatggtt 99  Q
    ||||||||||||||| | |||| ||||||||||||| |||| |||||||||    
18192401 gtatcttgattcaggatgttcaaatcacatgactggtcatagagaatggtt 18192451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University