View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9653_high_10 (Length: 371)
Name: NF9653_high_10
Description: NF9653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9653_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 20 - 368
Target Start/End: Original strand, 41704143 - 41704491
Alignment:
| Q |
20 |
ggtcccatttgagatatactcatagatcatcaaaggctgctcagattccacacagcaacctaagagtcttactaggttcttgtgattaacttgagaaagt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41704143 |
ggtcccatttgagatatactcatagatcatcaaaggctgctcagattccacacagcaacctaagagtcttactaggttcttgtgattaacttgagaaagt |
41704242 |
T |
 |
| Q |
120 |
attgaaacctcattaagcacttgttgtgtgcttttaaggttaccaactctagctttcttgacagctacaatagttccatcttgtagttcacctttgtaaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41704243 |
attgaaacctcattaagcacttgttgtgtgcttttaaggttaccaactctagctttcttgacagctacaatagttccatcttgtagttcacctttgtaaa |
41704342 |
T |
 |
| Q |
220 |
cttccccaaagccaccacttcctaggatcctgtcttgtgaaaaacagtttgttgctttcttcaactctttcagttgaaacattttgtaaggtttctcccc |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41704343 |
cttccccaaagccaccacttcctaggatcctgtcttgtgaaaaacagtttgttgctttcttcaactctttcagttgaaacattttgtaaggtttctcccc |
41704442 |
T |
 |
| Q |
320 |
tccagtgcttgatttcagcacaatttctctttccttggtctgcttctcc |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41704443 |
tccagtgcttgatttcagcacaatttctctttccttggcctgcttctcc |
41704491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 323 - 368
Target Start/End: Original strand, 1440620 - 1440665
Alignment:
| Q |
323 |
agtgcttgatttcagcacaatttctctttccttggtctgcttctcc |
368 |
Q |
| |
|
|||||||| |||||||| |||||||||||| |||||||||| |||| |
|
|
| T |
1440620 |
agtgcttggtttcagcagaatttctctttctttggtctgctactcc |
1440665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University