View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9653_high_14 (Length: 341)
Name: NF9653_high_14
Description: NF9653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9653_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 19 - 319
Target Start/End: Original strand, 12388334 - 12388634
Alignment:
| Q |
19 |
atgatatcccattgcattaactgcatctcttttcactttcttcttctcctcaatgctttgttcaaaaaacttcttggcctcaatctcaacctttgtgcta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
12388334 |
atgatatcccattgcattaactgcatctcttttcactttcttcttctcctcaatgctttgctcaaaaaactttttggcctcaatctcaacctttgtacta |
12388433 |
T |
 |
| Q |
119 |
acatcagatggaactccatgattgattacttgaaaaaatccccattcttcacatgccttgccaatctttgagatgaggttttcttgactactttctgaga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12388434 |
acatcagatggaactccatgattgattacttgaaaaaatccccattcttcacatgccttgccaatctttgagatgaggttttgttgactactttctgaga |
12388533 |
T |
 |
| Q |
219 |
ggtcaatgattggaatttcatcaacttgtacaaaggtagataacttaggacggtgttctgtggcttgtatgaaagatggatctatgtctcccatgttttg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12388534 |
ggtcaatgattggaatttcatcaacttgtacaaaggtagataacttaggacggtgttctgtggcttgtatgaaagatgaatctatgtctcccatgttttg |
12388633 |
T |
 |
| Q |
319 |
a |
319 |
Q |
| |
|
| |
|
|
| T |
12388634 |
a |
12388634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University