View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9653_high_21 (Length: 244)
Name: NF9653_high_21
Description: NF9653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9653_high_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 231
Target Start/End: Complemental strand, 2489129 - 2488916
Alignment:
| Q |
18 |
cactgcaaacctcagatgttactgcttgagcttctaacttcaatgaatctctgtcactgaattttcccgcctggaatattcccagagcatgggacaaact |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2489129 |
cactgcaaacctcagatgttactgcttgagcttctaacttcaatgaatctctgtcaccgaattttcccgcctggaatattcccagagcatgggacaaact |
2489030 |
T |
|
| Q |
118 |
gtttcgaaatacaattaagtaagtatataaaagttagattgttcatgcagcaaaatttgccggtctaacctgttgcatggaatgatcagttttccatttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2489029 |
gtttcgaaatacaattaagtaagtatataaaagttagattgttcatgcagcaaaatttgccggtctaacctgttgcatggaatgatcagttttccatttc |
2488930 |
T |
|
| Q |
218 |
tgtattcaggctct |
231 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
2488929 |
tgtattcaggctct |
2488916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University