View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9653_high_25 (Length: 239)
Name: NF9653_high_25
Description: NF9653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9653_high_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 154 - 222
Target Start/End: Original strand, 39185671 - 39185739
Alignment:
| Q |
154 |
gatgattcacctctctgttgtttccacgactcatgatttttctactctttttctgtttttgctcaaatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39185671 |
gatgattcacctctctgttgtttccacgactcatgatttttctactctttttctgtttttgctcaaatg |
39185739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 10 - 77
Target Start/End: Original strand, 39185531 - 39185598
Alignment:
| Q |
10 |
cagaaatatcgtaaaaccctaacgtttctctaaagaaacgatcgtgactaaatgcaaacgaaaatagt |
77 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39185531 |
cagaaatatcgtaaaaccctaacatttctctaaagaaacgatcgcgactaaatgcaaacgaaaatagt |
39185598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 144 - 222
Target Start/End: Complemental strand, 2101520 - 2101442
Alignment:
| Q |
144 |
gaagatgatggatgattcacctctctgttgtttccacgactcatgatttttctactctttttctgtttttgctcaaatg |
222 |
Q |
| |
|
||||| |||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2101520 |
gaagaagatgaacgattcacctctctgttgtttccacgactcatgatttttctactctttttatgtttttgctcaaatg |
2101442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University