View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9653_low_50 (Length: 246)
Name: NF9653_low_50
Description: NF9653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9653_low_50 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 43375859 - 43376079
Alignment:
| Q |
18 |
aatatgaatatgaatataacctttgttgagcaatgttcttgtcttgggttaaaaaggttgatttccagcctctaccaatgggagagttaggattatcatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43375859 |
aatatgaatatgaatataacctttgttgagcaatgttcttgtcttgggttaaaaaggttgatttccagcctctaccaatgggagagttaggattatcatc |
43375958 |
T |
 |
| Q |
118 |
ttcacccaaaactctaacatacaacaacccaaacttctcaagcttctccacaaattccggataacgatccttcatcctatcgtaaacaacatgactaaga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43375959 |
ttcacccaaaactctaacatacaacaacccaaacttctcaagcttctccacaaattccggataacgatccttcatcctatcgtaaacaacatgactaaga |
43376058 |
T |
 |
| Q |
218 |
acaatcggcgtttcaccacca |
238 |
Q |
| |
|
||||| ||||||||||||||| |
|
|
| T |
43376059 |
acaataggcgtttcaccacca |
43376079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University