View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9653_low_51 (Length: 244)

Name: NF9653_low_51
Description: NF9653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9653_low_51
NF9653_low_51
[»] chr5 (1 HSPs)
chr5 (18-231)||(2488916-2489129)


Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 231
Target Start/End: Complemental strand, 2489129 - 2488916
Alignment:
18 cactgcaaacctcagatgttactgcttgagcttctaacttcaatgaatctctgtcactgaattttcccgcctggaatattcccagagcatgggacaaact 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
2489129 cactgcaaacctcagatgttactgcttgagcttctaacttcaatgaatctctgtcaccgaattttcccgcctggaatattcccagagcatgggacaaact 2489030  T
118 gtttcgaaatacaattaagtaagtatataaaagttagattgttcatgcagcaaaatttgccggtctaacctgttgcatggaatgatcagttttccatttc 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2489029 gtttcgaaatacaattaagtaagtatataaaagttagattgttcatgcagcaaaatttgccggtctaacctgttgcatggaatgatcagttttccatttc 2488930  T
218 tgtattcaggctct 231  Q
    ||||||||||||||    
2488929 tgtattcaggctct 2488916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University